پایان نامه ارشد رایگان درباره ACT، نرم افزار، عدم تعادل

محلول TAE (10X) به آن اضافه شد.
سوسپانسیون حاصله را روی شعله حرارت داده تا آگارز در آن حل شود و محلول بهصورت شفاف درآید سپس ارلن در دمای محیط آزمایشگاه قرار گرفت تا سرد شود.
زمانی که دمای محلول به حدود دمای بدن رسید مقدار 10 میکرولیتر اتیدیوم بروماید 1% به آن اضافه و محلول کاملا هم زده شد.
محلول را درون قالب مخصوص (سینی ژل) به آرامی ریخته (جهت جلوگیری از ایجاد حباب) و اجاز داده شد تا ژل خود را بگیرد.
بعد از این که ژل خود را گرفت، داخل تانک الکتروفورز قرار داده شد و پس از مدتی (5 تا 10 دقیقه) شانه ژل به آرامی از ژل خارج گردید.
دو میکرولیتر بافر سنگین کننده را با پنج میکرولیتر از DNA استخراجی مخلوط کرده و در نهایت نمونهها را درون چاهکهای ایجاد شده میریزیم.
تانک الکتروفورز به منبع جریان برق متصل و ولتاژ دستگاه روی 70 ولت و 45 میلی‌آمپر به مدت 45 دقیقه تنظیم گردید.
پس از انجام الکتروفورز، ژل را از الکتروفورز خارج کرده و درون دستگاه UV قرار داده شد و با استفاده از اشعه UV، باندهای تشکیل شده مصور شدند و کیفیت و کمیت آنها بررسی شد.
شکل 3-3- تصویر دستگاه الکتروفورز افقی
7-3- واکنش زنجیره‌ای پلیمراز
مواد مورد استفاده: یک واحد بین المللی آنزیم تک DNA پلیمراز، 5/1 میلیمولار کلرید منیزیم ساخت شرکت سیناژن، 5/2 میلیمولار بافر PCR در غلظت X 10 ساخت شرکت سیناژن، 50 نانوگرم DNA استخراج شده، یک میکرومولار از هر یک از نشانگرهای ریزماهواره، آب مقطر استریل تا رسیدن به حجم 25 میکرولیتر.
وسایل مورد استفاده: نمونه‌بردارها با توانایی برداشتن 10، 20، 100 و میکرولیتر و میکروتیوپ‌های استریل مخصوص PCR به حجم 200 میکرولیتر، دستگاه ترموسایکلر (BIO-RAD, MJ Mini Thermal Cycler, USA).
1-7-3- انجام واکنش زنجیرهای پلیمراز (PCR)
1- برای هر نمونه یک میکروتیوپ 200 میکرولیتری استریل انتخاب و شماره نمونه و منطقه آن روی درب آن ثبت گردید. جهت بررسی تنوع ژنتیکی ماهی A. braschnikowi در سواحل دریای خزر از شش جفت نشانگر ریزماهواره AsaD030، AsaD042، AsaC051، AsaC059، AsaD312 و AsaD392 از مقاله انتشار یافته بر روی گونه Alosa sapidissima توسط جولیان و بارترون (2007) در آمریکا استفاده شد (جدول 1-4). واکنش زنجیره‌ای پلی مراز در دستگاه ترموسایکلر (BIO-RAD, MJ Mini Thermal Cycler) درون میکروتیوپهای مخصوص PCR شامل 50 نانوگرم DNA استخراجی، یک میکرومولار از پرایمر (F) و یک میکرومولار از پرایمر (R)، 2/0 میلیمـولار از نوکلئـوتیدها، یک واحـد بین‌المـللی تگ DNA پلی مـراز، 5/2 میلیمولار بافر PCR (10X)، 5/1 میلی‌مولار کلرید منیزیم و اضافه نمودن آب مقطر پزشکی تا رسیدن به حجم 25 میکرولیتر انجام شد. مراحل انجام واکنش زنجیره پلی مراز بدین صورت بود: در واسرشتگی اول، دمای 94 درجه سانتیگراد به مدت سه تا پنج دقیقه اعمال میشود و DNA دو رشته از هم جدا میشود (Denaturation)، در ادامه 35 چرخه شامل 45 ثانیه در دمای 94 درجه، دمای الحاق دو رشته DNA به مدت 30 ثانیه، 45 ثانیه در دمای 72 درجه و در بسط نهایی سه تا پنج دقیقه در دمای 72 درجه سانتی گراد صورت پذیرفت.
2- محتویات ویال ها توسط سمپلر خوب هم زده و ترکیب شد تا بخوبی همگن شوند.
8-3- بهینه سازی PCR
ابتدا با دادن دامنه حرارتی به دستگاه ترموسایکلر بهترین دمای اتصال هر کدام از آغازگرها به رشته الگو به دست آمد و در مرحله بعد جهت تظاهر خوب باندها و حذف باندهای اضافی تکثیر شده، غلظت Mgcl2 بهینه سازی گردید. مقدار Mgcl2 بین 5/0 تا 1 میلیمولار تغییر داده شد تا بهترین وضوح باندها بهدستآید.
9-3- الکتروفورز محصول PCR، با استفاده از ژل پلی آکریل آمید 6%
محصول نهایی PCR با استفاده از ژل اکریلآمید 6% بررسی شد.
مواد مورد نیاز: آب مقطر دو بار تقطیر شده، آکریل آمید، بافر TBE(10X)، آمونیوم پرسولفات، TEMED، بافر سنگین کننده، نشانگر (Ladder) bp100 (ساخت شرکت MBI Fermentase) جهت تعیین وزن آللها.
وسایل مورد استفاده:
دستگاه الکتروفورز عمودی.نمونهبردار با توانایی نمونهبرداری 20 میکرولیتر.
10-3- روش تهیه ژل آکریل آمید
در داخل یک بشر ابتدا 5/23 میلیلیتر آب مقطر با 6 میلیلیتر اکریلآمید (30 درصد) و 3 میلیلیتر TBE(10X) مخلوط شدند. سپس 5/27 میکرولیتر محلول TEMED و 253 میکرولیتر APS به محلول داخل بشر اضافه گردید و به سرعت خوب همگن شدند. سپس محلول نهایی را به فضای محصور بین دو شیشه مخصوص که قبلا تهیه شده بود، به آرامی منتقل گردید تا حباب ایجاد نشود. سپس شانههای ایجاد کننده چاهک در جای خود قرار گرفتند. پس از بسته شدن ژل (حدود 30 دقیقه) شانهها را برداشته و چاهکای ایجاد شده را با بافر TBE(1X) خوب شستشو میدهیم؛ بهگونهای که هیچ ذرهای از قطعات ژل احتمالی روی چاهکها نماند. نمونههای حاصل از محصول نهایی PCR در موقع تزریق به چاهکها ابتدا هر کدام با 2 میکرولیتر بافر سنگین کننده خوب مخلوط شدند و سپس به ترتیب در محل چاهکها ریخته شدند. یکی از چاهکها در هر ژل اختصاص به Ladder دارد. ژل در ستون عمودی بافر حاوی TBE(1X) قرار گرفت و با روشن نمودن دستگاه و تنظیم مولد برق آن بر روی ولتاژ 200 ولت، الکتروفورز نمونهها به مدت 4 ساعت انجام شد.
شکل 4-3- تصویری از دستگاه الکتروفورز عمودی مورد استفاده در مطالعه حاضر
11-3- رنگ آمیزی ژل پلی آکریل آمید با روش نیترات نقره
مواد مورد استفاده: آب مقطر دوبار تقطیر، اتانول 96%، اسید استیک، نیترات نقره، NaOH، NaBH4، فرمالدهید.
تجهیزات مورد استفاده: شیکر، ترازوی دیجیتال با دقت 001/0 گرم، ظروف رنگ آمیزی.
روش کار:
بافر A: برای ساخت بافر A، 40 میلی‌لیتر اتانول و 2 میلی‌لیتر اسید استیک و 350 میلی‌لیتر آب مقطر استفاده شد. بافر B شامل مقدار 3/0 گرم نیترات نقره در 200 میلی‌لیتر آب مقطر بود. برای ساخت بافر C، ابتدا 5/4 گرم سود را در 300 میلی‌لیتر آب مقطر حل کرده و سپس 03/0 گرم NaBH4 1% به آنها اضافه گردید و در نهایت 2 میلی‌لیتر فرمالدهید به محلول اضافه شد. برای رنگ آمیزی، به مدت 7 دقیقه ژلها را در بافر A قرار داده، سپس بافر A را تخلیه کرده و 10 دقیقه در بافر B شستشو داده و سپس ژل دو بار در آب مقطر سرد شستشو گردید. سرانجام ژل در بافر C قرار داده شد تا باندها ظاهر شوند. در نهایت بافر C دور ریخته و ژل بین دو ورق پلاستیکی شفاف بستهبندی شد.
12-3- ثبت تصاویر
پس از رنگآمیزی ژل، تصویر با کیفیتی از آن توسط دستگاه مستندساز ژل (Gel Doc XR, BIO-RAD) تهیه شد. سپس با استفاده از نرمافزار ژل پرو آنالایزر Gel pro analyser 3.0. Gene, USA)) وزن باندهای مشاهده شده در باند اصلی در مقایسه با مارکر الگو (Ladder) مشخص گردید. سپس باندهای حاصل در کل نمونهها از اندازه کوچک به بزرگ شماره‌دهی شد. بدین ترتیب آللهای حاصل کدگذاری گردیدند.
شکل 5-3- تصویری از دستگاه مستند ساز ژل
13-3- آنالیز آماری
به منطور محاسبه تعداد آلل در هر یک از جایگاههای ژنی، هتروزیگوسیتی مشاهده شده و مورد انتظار، شاخص شانون و همچنین آزمون انحـراف از تعادل هاردی- واینبرگ و از نرم افزار GenAlex 6.41 (پیکال و اسموس، 2006) استفاده شد. ظرفیت اطلاعات چند شکلی هر نشانگر با استفاده از نرم‌افزارver 3.0.3 Cervus بهدست آمد (بوتستین و همکاران، 1980). همچنین جهت بررسی وجود آلل نول، خطاهای دسته‌بندی و یا از دست دادن آلل بزرگ، نرمافزارMicrochecker 2.2.1 (اوسترهوت، 2004) مورد استفاده قرار گرفت. از آزمون منویتنی غیر پارامتریک در نرم‌افزارSPSS ver 19 (زر، 1999) به منظور تعیین معنیدار بودن اختلاف در مقادیر هتروزیگوسیتی مشاهده شده (Ho) و مورد انتظار (He) استفاده شد. با استفاده از نرم افزار FSTAT ver 2.9.3 آنالیز غنای آللی، میزان ضریب درون آمیزی (Fis) و سطح معنیداری آن مشخص گردید (گودت، 2001). میزان تنوع درون و بین منطقهای و همچنین میزان تمایز بین مناطق بر اساس معیار مدل آللی بینهایت (Fst) و مدل جهش پله‌ای (Rst) توسط آنالیز واریانس مولکولی (AMOVA) در نرمافزارGenAlex محاسبه شد (پیکال و اسموس، 2006). همچنین میزان آلل واقعی (Na)، آلل مؤثر (Ne)، جریان ژنی (Nm) و فراوانی اللی26 نیز در همین نرمافزار بهدست آمد (پیکال و اسموس، 2006) تست عدم تعادل پیوستگی (disequilibrium linkage) بین جفت جایگاههای ژنی توسط نرم افزار GENEPOP 3.1 (ریموند و روزت، 2003) صورت پذیرفت. مقادیر فاصله ژنتیکی (D) و شباهت ژنتیکی براساس شاخص نئی27 (I) با استفاده از تست مربع لاتین (X2) محاسبه شد (نئی، 1978) و با استفاده از تست منتل28، رابطه بین فاصله جغرافیایی و فاصله ژنتیکی بررسی گردید. همچنین رسم دندروگرام UPGMA در نرم افزار Ver 2.02e NTSYSpc (یه و همکاران، 1999) بر اساس شباهت ژنتیکی بهدست آمده از شاخص نئی صورت پذیرفت.
فصل چهارم
نتایج
4- نتایج
1-4- نتایج حاصل از بررسی کیفیت و کمیت DNA استخراجی از شگماهی براشنیکوی در مطالعه حاضر
کیفیت DNA استخراجی با استفاده از روش الکتروفورز افقی ژل آگاروز یک درصد و کمیت آن با استفاده از دستگاه اسپکتروفتومتر تعیین گردید. باندهای تشکیل شده در ژل آگاروز یک درصد دارای وضوح و شدت قابل قبول بودند که این موضوع نشاندهنده پایین بودن میزان آلودگیهای فنولی، پروتئینی و یا آلودگی ناشی از RNA است؛ در نتیجه امکان استفاده از آنها برای تکثیر در واکنش زنجیرهای پلیمراز وجود داشت (شکل 1-4). همچنین نتایج حاصل از بررسی کمیت DNAهای استخراجی از ماهیان مورد مطالعه در دستگاه نانودراپ نیز نشان داد که نسبت جذب در طول موج 260 نانومتر به طول موج 280 نانومتر در بازه 2-85/1 بود و برای نمونههایی که این نسبت کمتر بود عمل استخراج DNA تکرار گردید. غلظت DNA در تمامی نمونهها 50 تا 70 نانوگرم بود.
شکل 1-4- تصویری از ژل آگارز یک درصد و باندهای تشکیل شده از DNA بر روی آن
2-4- نتایج حاصل از واکنش زنجیرهای پلیمراز
بهترین دمای الحاق نشانگرهای مورد استفاده، تعداد آلل و دامنه آللی مشاهده شده در هر یک از جفت نشانگرهای مورد استفاده در تحقیق حاضر در جدول 1-4 آورده شده است. در این تحقیق هر شش جایگاه ژنی ریزماهواره استفاده شده حالت پلی مورفیسم نشان دادند (اشکال 2-4 تا 7-4) و نتایج حاصل از ظرفیت اطلاعات چندشکلی (PIC) میزان بالایی از چندشکلی را در جایگاههای ژنی مورد استفاده نشان داد (جدول 2-4). همچنین هیچ یک از جایگاههای ژنی عدم تعادل پیوستگی از خود نشان ندادند (684/0P=).
جدول 1-4- جایگاه‌های ژنی مورد استفاده در این مطالعه و خصوصیات آنها
جایگاه ژنی
کد دسترسی در بانکژنی NCBI
تعدادآلل
اندازه آلل
توالی پرایمر (5′-3′)
دمای‌الحاق (0c)
AsaD030
EF014998
13
152-104
F: CCACAGCATCATCTCTTTACTG
R: ACCTTGAATTTCTCCTTGGG
55
AsaD042
EF015000
17
192-124
F:ACTGGTCAATTGTAAGACACCC
R:CAAGATGACCAAGGGTTAAGAC
50
AsaC051
EF014992
27
192-132
F: GTAAGTCGCTTTGGACTACCAG
R:TCTAAATGCCCAGGTAAAGATG
53
AsaC059
EF014993
26
392-288
F: CTTGGACTTACAATGCTTTTGG
R: AGCAAGTGTGGAGTCAGTCG
53
AsaD312
EF014999
16
192-132
F: TAAACATACTGCTCCTTCACCC
R: ATGTGCTCTTGTTTCAATGATG
54
AsaD392
EF015004
30
280-128
F:ATGATGTAAAACCAGGAGATGC
R: CATAGGTCTTAAAACGTGGGTG
53
جدول 2-4- نتایج حاصل از ظرفیت اطلاعات چند شکلی (PIC) نشانگرهای مورد استفاده در مطالعه حاضر
جایگاه

دیدگاهتان را بنویسید